| typora-copy-images-to | sequence-fold | command-fold | last-update |
|---|---|---|---|
./ |
80 xclip -o | tr -d "\n" | fold -w80 |
75 xclip -o | tr -d "\n" | fold -sw75 | sed -e 's/$/\\/' |
April 2nd, 2018 |
by alper yilmaz for GTU Bioinformatics Program Course
2019-03-14 (PDF version of this document is accessible at goo.gl/bhrkqQ and html version is available at https://goo.gl/siUoax)
[TOC]
| Global Sequence Alignment | Local Sequence Alignment |
|---|---|
| In global alignment, an attempt is made to align the entire sequence (end to end alignment) | Finds local regions with the highest level of similarity between the two sequences. |
| A global alignment contains all letters from both the query and target sequences | A local alignment aligns a substring of the query sequence to a substring of the target sequence. |
| If two sequences have approximately the same length and are quite similar, they are suitable for global alignment. | Any two sequences can be locally aligned as local alignment finds stretches of sequences with high level of matches without considering the alignment of rest of the sequence regions. |
| Suitable for aligning two closely related sequences. | Suitable for aligning more divergent sequences or distantly related sequences. |
| Global alignments are usually done for comparing homologous genes like comparing two genes with same function (in human vs. mouse) or comparing two proteins with similar function. | Used for finding out conserved patterns in DNA sequences or conserved domains or motifs in two proteins. |
| A general global alignment technique is the Needleman–Wunsch algorithm. | A general local alignment method is Smith–Waterman algorithm. |
- Basic Local Alignment Search Tool
- http://blast.ncbi.nlm.nih.gov/
- Are there sequences in databases/databanks similar to my sequence?
Functions of BLAST
- Identify species
- Locating domains
- Establishing phylogeny
- Comparison
AACGTTTCCAGTCCAAATAGCTAGGC
===--=== =-===-==-======
AACCGTTC TACAATTACCTAGGC
Hits(+1): 18
Misses (-2): 5
Gaps (existence -2, extension -1): 1 Length: 3
Score = 18 * 1 + 5 * (-2) – 2 – 2 = 4
BLOSUM62 Substitution Matrix
