nextflow.config

/*
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    saltprofiler Nextflow config file
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    Default config options for all compute environments
----------------------------------------------------------------------------------------
*/

// Global default params, used in configs
params {

    // Input options
    input                                = null
    assembly_input                       = null
    single_end                           = false

    // short read preprocessing options
    skip_clipping                        = false
    clip_tool                            = 'fastp'
    save_clipped_reads                   = false
    reads_minlength                      = 15
    fastp_save_trimmed_fail              = false
    fastp_qualified_quality              = 15
    fastp_cut_mean_quality               = 15
    adapterremoval_minquality            = 2
    adapterremoval_adapter1              = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG'
    adapterremoval_adapter2              = 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
    adapterremoval_trim_quality_stretch  = false
    keep_phix                            = false
    // phix_reference                    = "ftp://ftp.ncbi.nlm.nih.gov/genomes/genbank/viral/Enterobacteria_phage_phiX174_sensu_lato/all_assembly_versions/GCA_002596845.1_ASM259684v1/GCA_002596845.1_ASM259684v1_genomic.fna.gz"
    phix_reference                       = "${baseDir}/assets/data/GCA_002596845.1_ASM259684v1_genomic.fna.gz"
    save_phixremoved_reads               = false
    host_fasta                           = null
    host_fasta_bowtie2index              = null
    host_genome                          = null
    host_removal_verysensitive           = false
    host_removal_save_ids                = false
    save_hostremoved_reads               = false
    bbnorm                               = false
    bbnorm_target                        = 100
    bbnorm_min                           = 5
    save_bbnorm_reads                    = false

    // binning options
    bowtie2_mode                         = null
    binning_map_mode                     = 'group'
    save_assembly_mapped_reads           = false
    skip_binning                         = false
    min_contig_size                      = 1500
    min_length_unbinned_contigs          = 1000000
    max_unbinned_contigs                 = 100
    skip_prokka                          = false
    skip_saltgenes                       = false

    // assembly options
    coassemble_group                     = false
    spades_options                       = null
    megahit_options                      = null
    skip_spades                          = false
    skip_megahit                         = false
    skip_quast                           = false
    skip_prodigal                        = false

    // taxonomy options
    skip_metaphlan                       = false
    skip_taxbins                         = false
    cat_db                               = null
    cat_db_generate                      = false
    cat_official_taxonomy                = false
    save_cat_db                          = false
    taxtable                             = "${baseDir}/assets/taxtable_kraken.tsv"
    taxtool                              = "kraken"
    kraken_db                            = null

    // binning options
    skip_metabat2                       = false

    // Bin QC
    skip_binqc                           = false
    binqc_tool                           = 'checkm'
    busco_db                             = 'https://busco-data.ezlab.org/v5/data/lineages/bacteria_odb10.2024-01-08.tar.gz'
    busco_auto_lineage_prok              = false
    save_busco_db                        = false
    busco_clean                          = false
    checkm_download_url                  = "https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz"
    checkm_db                            = null
    save_checkm_data                     = false

    // Salt gene profiling
    genes_input                          = "${baseDir}/assets/genes.csv"

    // Reproducibility options
    megahit_fix_cpu_1                    = false
    spades_fix_cpus                      = -1
    metabat_rng_seed                     = 1

    // References
    genome                              = null
    igenomes_base                       = 's3://ngi-igenomes/igenomes/'
    igenomes_ignore                     = false

    // MultiQC options
    multiqc_config                      = null
    multiqc_title                       = null
    multiqc_logo                        = null
    max_multiqc_email_size              = '25.MB'
    multiqc_methods_description         = null

    // Boilerplate options
    outdir                       = null
    publish_dir_mode             = 'copy'
    email                        = null
    email_on_fail                = null
    plaintext_email              = false
    monochrome_logs              = false
    hook_url                     = null
    help                         = false
    version                      = false
    pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/'

    monochromeLogs              = null // TODO remove once nf-validation removes the bug

    // Config options
    config_profile_name        = null
    config_profile_description = null
    custom_config_version      = 'master'
    custom_config_base         = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}"
    config_profile_contact     = null
    config_profile_url         = null

    // Max resource options
    // Defaults only, expecting to be overwritten
    max_memory                           = '125.GB'
    max_cpus                             = 16
    max_time                             = '240.h'

    // Schema validation default options
    validationFailUnrecognisedParams = false
    validationLenientMode            = false
    validationSchemaIgnoreParams     = 'genome,genomes,igenomes_base,monochromeLogs'
    validationShowHiddenParams       = false
    validate_params                  = true

}

// Load base.config by default for all pipelines
includeConfig 'conf/base.config'

// Load nf-core custom profiles from different Institutions
try {
    includeConfig "${params.custom_config_base}/nfcore_custom.config"
} catch (Exception e) {
    System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config")
}

// Load nf-core/mag custom profiles from different institutions.
try {
    includeConfig "${params.custom_config_base}/pipeline/mag.config"
} catch (Exception e) {
    System.err.println("WARNING: Could not load nf-core/config/mag profiles: ${params.custom_config_base}/pipeline/mag.config")
}

profiles {
    debug {
        dumpHashes              = true
        process.beforeScript    = 'echo $HOSTNAME'
        cleanup                 = false
        nextflow.enable.configProcessNamesValidation = true
    }
    conda {
        conda.enabled           = true
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        conda.channels          = ['conda-forge', 'bioconda', 'defaults']
        apptainer.enabled       = false
    }
    mamba {
        conda.enabled           = true
        conda.useMamba          = true
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    docker {
        docker.enabled          = true
        conda.enabled           = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
        docker.runOptions       = '-u $(id -u):$(id -g)'
    }
    arm {
        docker.runOptions       = '-u $(id -u):$(id -g) --platform=linux/amd64'
    }
    singularity {
        singularity.enabled     = true
        singularity.autoMounts  = true
        conda.enabled           = false
        docker.enabled          = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    podman {
        podman.enabled          = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    shifter {
        shifter.enabled         = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    charliecloud {
        charliecloud.enabled    = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        apptainer.enabled       = false
    }
    apptainer {
        apptainer.enabled       = true
        apptainer.autoMounts    = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
    }
    wave {
        apptainer.ociAutoPull   = true
        singularity.ociAutoPull = true
        wave.enabled            = true
        wave.freeze             = true
        wave.strategy           = 'conda,container'
    }
    gitpod {
        executor.name           = 'local'
        executor.cpus           = 4
        executor.memory         = 8.GB
    }
    snellius {
        process {
            executor = 'slurm'
            clusterOptions = '-p genoa'
        }
        executor {
            name = 'slurm'
            queueSize = 70
            submitRateLimit = '10 sec'
            jobName = {
                n = "${task.name}" -> n.replaceAll( '[,():\\s]', '_')
            }
        }
        singularity.enabled    = true
        singularity.autoMounts = true
        conda.enabled          = false
        docker.enabled         = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false

    }
    test                      { includeConfig 'conf/test.config'                      }
    test_full                 { includeConfig 'conf/test_full.config'                 }
    test_host_rm              { includeConfig 'conf/test_host_rm.config'              }
    test_busco_auto           { includeConfig 'conf/test_busco_auto.config'           }
    test_adapterremoval       { includeConfig 'conf/test_adapterremoval.config'       }
    test_binning_entry        { includeConfig 'conf/test_binning_entry.config'        }
    test_no_clipping          { includeConfig 'conf/test_no_clipping.config'          }
    test_bbnorm               { includeConfig 'conf/test_bbnorm.config'               }
    test_nothing              { includeConfig 'conf/test_nothing.config'              }
    test_single_end           { includeConfig 'conf/test_single_end.config'           }
}

// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile
// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled
// Set to your registry if you have a mirror of containers
apptainer.registry   = 'quay.io'
docker.registry      = 'quay.io'
podman.registry      = 'quay.io'
singularity.registry = 'quay.io'

// Nextflow plugins
plugins {
    id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet
}

// Load igenomes.config if required
if (!params.igenomes_ignore) {
    includeConfig 'conf/igenomes.config'
} else {
    params.genomes = [:]
}
// Export these variables to prevent local Python/R libraries from conflicting with those in the container
// The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container.
// See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable.

env {
    PYTHONNOUSERSITE = 1
    R_PROFILE_USER   = "/.Rprofile"
    R_ENVIRON_USER   = "/.Renviron"
    JULIA_DEPOT_PATH = "/usr/local/share/julia"
}

// Capture exit codes from upstream processes when piping
process.shell = ['/bin/bash', '-euo', 'pipefail']

// Disable process selector warnings by default. Use debug profile to enable warnings.
nextflow.enable.configProcessNamesValidation = false

def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
timeline {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html"
}
report {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html"
}
trace {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt"
}
dag {
    enabled = true
    file    = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html"
}

manifest {
    name            = 'saltprofiler'
    author          = """nf-core/mag authors and Barbara Verhaar"""
    homePage        = 'https://github.com/barbarahelena/saltprofiler'
    description     = """Assembly, binning and annotation of metagenomes with profiling of halotolerance genes"""
    mainScript      = 'main.nf'
    nextflowVersion = '!>=23.04.0'
    version         = '0.1.0'
    doi             = 'NA'
}

// Load modules.config for DSL2 module specific options
includeConfig 'conf/modules.config'

// Function to ensure that resource requirements don't go beyond
// a maximum limit
def check_max(obj, type) {
    if (type == 'memory') {
        try {
            if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1)
                return params.max_memory as nextflow.util.MemoryUnit
            else
                return obj
        } catch (all) {
            println "   ### ERROR ###   Max memory '${params.max_memory}' is not valid! Using default value: $obj"
            return obj
        }
    } else if (type == 'time') {
        try {
            if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1)
                return params.max_time as nextflow.util.Duration
            else
                return obj
        } catch (all) {
            println "   ### ERROR ###   Max time '${params.max_time}' is not valid! Using default value: $obj"
            return obj
        }
    } else if (type == 'cpus') {
        try {
            return Math.min( obj, params.max_cpus as int )
        } catch (all) {
            println "   ### ERROR ###   Max cpus '${params.max_cpus}' is not valid! Using default value: $obj"
            return obj
        }
    }
}

// Functions to fix number of cpus to allow reproducibility for MEGAHIT and SPAdes
// if corresponding parameters are specified, number of cpus is not increased with retries
def check_megahit_cpus (x, attempt ) {
    if (params.megahit_fix_cpu_1) return 1
    else return check_max (x * attempt, 'cpus' )
}
def check_spades_cpus (x, attempt ) {
    if (params.spades_fix_cpus != -1) return check_max (params.spades_fix_cpus, 'cpus' )
    else return check_max (x * attempt, 'cpus' )
}