diff --git a/cutadapt/Dockerfile b/cutadapt/Dockerfile
index 03a5cd9..5be3c0a 100644
--- a/cutadapt/Dockerfile
+++ b/cutadapt/Dockerfile
@@ -7,7 +7,7 @@
 # Set the base image to Ubuntu
 FROM ubuntu:20.04
 
-ARG PACKAGE_VERSION=2.10
+ARG PACKAGE_VERSION=4.0
 ARG BUILD_PACKAGES="build-essential"
 ARG DEBIAN_FRONTEND=noninteractive
 
diff --git a/cutadapt/README.md b/cutadapt/README.md
index 857bea7..cc8994d 100644
--- a/cutadapt/README.md
+++ b/cutadapt/README.md
@@ -31,11 +31,10 @@ nextflow run main.nf -params-file params.json
 **Required**:
 
 * `input_R1`: Read1 fastq file. This is assumed to be in a gzipped form.
-* `input_R2`: Read2 fastq file. This is assumed to be in a gzipped form.
 * `publish_dir`: the final location for the results.
 
 **Optional**:
-
+* `input_R2`: Read2 fastq file. This is assumed to be in a gzipped form. Default: No_File, which forces cutadapt to run for single end
 * `read1_adapter` : Override the adapter for read 1. Default: "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
 * `read2_adapter` : Override the adapter for read 2. Default: "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
 * `min_length` : set the minimum length permitted for reads. Default: 1
@@ -61,10 +60,7 @@ Examples of these files are located in [tests/expected](tests/expected).
 ### Metrics
 
 Current metrics captured in the qc_metrics file include:
-* `adapter_read1_percent `: the percent of read 1's that contained adapter sequence.
-* `adapter_read2_percent`: the percent of read 2's that contained adapter sequence.
-* `quality_trimmed_percent`: the percent of reads that were trimmed for quality.
-  By default, this should be 0, because by default, quality trimming is turned off.
+* `adapter_percent `: the percent of reads that contained adapter sequence.
 
 
 ## Local Testing
@@ -79,7 +75,7 @@ wfpm workon cutadapt
 3. Build the Docker container locally
 ```
 cd cutadapt
-docker build -t ghcr.io/icgc-argo-qc-wg/argo-qc-tools.cutadapt:3.4.0 .
+docker build -t ghcr.io/icgc-argo-qc-workflows/argo-qc-tools.cutadapt:0.2.1 .
 ```
 4. Run the tests
 ```
@@ -92,6 +88,7 @@ If everything works correctly, you should see something like the following:
 Validating package: /Users/mtaschuk/git/argo-qc-tools/cutadapt
 Pakcage valid.
 Testing package: /Users/mtaschuk/git/argo-qc-tools/cutadapt
-[1/1] Testing: /Users/mtaschuk/git/argo-qc-tools/cutadapt/tests/test-job-1.json. PASSED
-Tested package: cutadapt, PASSED: 1, FAILED: 0
+[1/2] Testing: /Users/mtaschuk/git/argo-qc-tools/cutadapt/tests/test-job-1.json. PASSED
+[2/2] Testing: /Users/mtaschuk/git/argo-qc-tools/cutadapt/tests/test-job-2.json. PASSED
+Tested package: cutadapt, PASSED: 2, FAILED: 0
 ```
diff --git a/cutadapt/main.nf b/cutadapt/main.nf
index d235bf1..7bd62ba 100755
--- a/cutadapt/main.nf
+++ b/cutadapt/main.nf
@@ -29,7 +29,7 @@
 /* this block is auto-generated based on info from pkg.json where   */
 /* changes can be made if needed, do NOT modify this block manually */
 nextflow.enable.dsl = 2
-version = '0.1.1'  // package version, changed from 3.4.0 so it doesnt match cutadapt
+version = '0.2.0'  // package version, changed from 3.4.0 so it doesnt match cutadapt
 
 container = [
     'ghcr.io': 'ghcr.io/icgc-argo-workflows/argo-qc-tools.cutadapt'
@@ -49,9 +49,9 @@ params.publish_dir = ""  // set to empty string will disable publishDir
 
 
 // tool specific params go here, add / change as needed
+params.read_group_id = ""
 params.input_R1=""
-params.input_R2=""
-params.output_pattern = "*.cutadapt.log.qc.tgz"  // output file name pattern
+params.input_R2="No_File"
 params.read1_adapter="AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
 params.read2_adapter="AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"
 params.min_length=1
@@ -60,31 +60,35 @@ params.extra_options=""
 
 process cutadapt {
   container "${params.container ?: container[params.container_registry ?: default_container_registry]}:${params.container_version ?: version}"
-  publishDir "${params.publish_dir}/${task.process.replaceAll(':', '_')}", mode: "copy", enabled: params.publish_dir
+  publishDir "${params.publish_dir}/${task.process.replaceAll(':', '_')}", mode: "copy", enabled: params.publish_dir ? true : false
 
   cpus params.cpus
   memory "${params.mem} GB"
 
   input:
-    path input_R1
-    path input_R2
+    tuple val(read_group_id), path(input_R1), path(input_R2)
 
   output:
-    path "output_dir/${params.output_pattern}", emit: output_tgz
+    path "output_dir/*.cutadapt.tgz", emit: cutadapt_tar
+    path "output_dir/*.cutadapt.log", emit: cutadapt_log
+    path "output_dir/*{fq,fastq,fq.gz,fastq.gz}", emit: cutadapt_results
 
   script:
     // add and initialize variables here as needed
 
+    arg_input_R2 = input_R2.name != 'No_File' ? "-2 ${input_R2}" : ""
+
     """
     mkdir -p output_dir
 
     main.py \
-      -1 ${input_R1} -2 ${input_R2} \
+      -1 ${input_R1} \
+      -r ${read_group_id} \
       -o output_dir \
       -a ${params.read1_adapter} \
       -A ${params.read2_adapter} \
       -m ${params.min_length} \
-      -q ${params.qual_cutoff} ${params.extra_options}
+      -q ${params.qual_cutoff} ${arg_input_R2} ${params.extra_options}
     """
 }
 
@@ -93,7 +97,6 @@ process cutadapt {
 // using this command: nextflow run icgc-argo-workflows/argo-qc-tools/cutadapt/main.nf -r cutadapt.v3.4.0 --params-file
 workflow {
   cutadapt(
-    file(params.input_R1),
-    file(params.input_R2)
+    tuple(params.read_group_id, file(params.input_R1), file(params.input_R2))
   )
 }
diff --git a/cutadapt/main.py b/cutadapt/main.py
index c39b8af..d2d23d5 100755
--- a/cutadapt/main.py
+++ b/cutadapt/main.py
@@ -33,6 +33,7 @@
 import re
 import json
 import tarfile
+import hashlib
 
 def run_cmd(cmd):
     proc = subprocess.Popen(
@@ -61,7 +62,7 @@ def prepare_tarball(qc_metrics, logfile):
 
     files_to_tar = ['tar_content.json', qc_metrics, logfile]
 
-    tarfile_name = f"{os.path.dirname(logfile)}/{os.path.basename(logfile)}.qc.tgz"
+    tarfile_name = re.sub(r'.log$', r'.tgz', logfile)
     with tarfile.open(tarfile_name, "w:gz") as tar:
         for f in files_to_tar:
             tar.add(f, arcname=os.path.basename(f))
@@ -82,15 +83,13 @@ def prep_qc_metrics(cutadapt_log, tool_ver):
         },
         'metrics': {}
     }
+
     with open(cutadapt_log,'r') as l:
         log=l.read()
-        r1_adapt=re.search("Read 1 with adapter:\s+\d+.+(\d+\.\d+)%",log)
-        r2_adapt=re.search("Read 2 with adapter:\s+\d+.+(\d+\.\d+)%",log)
-        q_trim=re.search("Quality-trimmed:\s+\d+.+(\d+\.\d+)%",log)
-
-    qc_metrics['metrics']['adapter_read1_percent']=float(r1_adapt.group(1))
-    qc_metrics['metrics']['adapter_read2_percent']=float(r2_adapt.group(1))
-    qc_metrics['metrics']['quality_trimmed_percent']=float(q_trim.group(1))
+        adapt=re.search("Read 1 with adapter:\s+\d+.+(\d+\.\d+)%",log)
+        if adapt is None:
+            adapt=re.search("Reads with adapters:\s+\d+.+(\d+\.\d+)%",log)
+    qc_metrics['metrics']['adapter_percent']=float(adapt.group(1))
 
     qc_metrics_file = f"{os.path.dirname(cutadapt_log)}/{os.path.basename(cutadapt_log)}.qc_metrics.json"
     with open(qc_metrics_file, "w") as j:
@@ -110,7 +109,9 @@ def main():
     parser.add_argument('-1', '--input-R1', dest='input_R1', type=str,
                         help='Input file read 1', required=True)
     parser.add_argument('-2', '--input-R2', dest='input_R2', type=str,
-                        help='Input file read 2', required=True)
+                        help='Input file read 2')
+    parser.add_argument('-r', '--rg_id', dest='rg_id', type=str,
+                        help='Read group ID', required=True)
     parser.add_argument('-o', '--output-dir', dest='output_dir', type=str,
                         help='Output directory', required=True)
     parser.add_argument('-a', '--read1-adapter', dest='adapter_R1', type=str,
@@ -130,18 +131,27 @@ def main():
 
     if not os.path.isfile(args.input_R1):
         sys.exit('Error: specified input file %s does not exist or is not accessible!' % args.input_R1)
-    if not os.path.isfile(args.input_R2):
+    if args.input_R2 and not os.path.isfile(args.input_R2):
         sys.exit('Error: specified input file %s does not exist or is not accessible!' % args.input_R2)
     if not os.path.isdir(args.output_dir):
         sys.exit('Error: specified output dir %s does not exist or is not accessible!' % args.output_dir)
 
-    basename=os.path.basename(args.input_R1)
-    index_of_dot=basename.index('.')
-    base=basename[:index_of_dot]
+    basename_R1=os.path.basename(args.input_R1)
+
+    if args.input_R2:
+      basename_R2=os.path.basename(args.input_R2)
+      cmd = f"cutadapt -q {args.min_trim_qual} -m {args.min_trim_len} -a {args.adapter_R1} -A {args.adapter_R2} -o {args.output_dir}/trim_{basename_R1} -p {args.output_dir}/trim_{basename_R2} {args.input_R1} {args.input_R2}"
+    else:
+      cmd = f"cutadapt -q {args.min_trim_qual} -m {args.min_trim_len} -a {args.adapter_R1} -o {args.output_dir}/trim_{basename_R1} {args.input_R1}"
+
 
-    stdout, stderr, returncode = run_cmd(f"cutadapt -q {args.min_trim_qual} -m {args.min_trim_len} -a {args.adapter_R1} -A {args.adapter_R2} -o {args.output_dir}/out.fastq.gz -p {args.output_dir}/out2.fastq.gz {args.input_R1} {args.input_R2}")
+    stdout, stderr, returncode = run_cmd(cmd)
+    # in case the rg_id contains filename not friendly characters
+    friendly_rgid = "".join([ c if re.match(r"[a-zA-Z0-9\.\-_]", c) else "_" for c in args.rg_id ])
+    # calculate md5 and add it in the logfile name to avoid name colision
+    md5sum = hashlib.md5((args.rg_id).encode('utf-8')).hexdigest()
 
-    logfile=f"{args.output_dir}/{base}.cutadapt.log"
+    logfile=f"{args.output_dir}/{friendly_rgid}.{md5sum}.cutadapt.log"
     with open(logfile,"w") as log:
         log.write(stdout)
 
diff --git a/cutadapt/pkg.json b/cutadapt/pkg.json
index d84486e..44d154d 100644
--- a/cutadapt/pkg.json
+++ b/cutadapt/pkg.json
@@ -1,6 +1,6 @@
 {
     "name": "cutadapt",
-    "version": "0.1.1",
+    "version": "0.2.0",
     "description": "CutAdapt tool",
     "main": "main.nf",
     "deprecated": false,
@@ -37,4 +37,4 @@
     "license": "MIT",
     "bugReport": "https://github.com/icgc-argo-workflows/argo-qc-tools/issues",
     "homepage": "https://github.com/icgc-argo-workflows/argo-qc-tools#readme"
-}
+}
\ No newline at end of file
diff --git a/cutadapt/tests/checker.nf b/cutadapt/tests/checker.nf
index dd64844..c80eb48 100755
--- a/cutadapt/tests/checker.nf
+++ b/cutadapt/tests/checker.nf
@@ -27,7 +27,7 @@
 /* this block is auto-generated based on info from pkg.json where   */
 /* changes can be made if needed, do NOT modify this block manually */
 nextflow.enable.dsl = 2
-version = '0.1.1'  // package version
+version = '0.2.0'  // package version
 container = [
     'ghcr.io': 'ghcr.io/icgc-argo-workflows/argo-qc-tools.cutadapt'
 ]
@@ -38,8 +38,11 @@ params.container_registry = ""
 params.container_version = ""
 params.container = ""
 // tool specific parmas go here, add / change as needed
-params.input_file = ""
+params.read_group_id = ""
+params.input_R1=""
+params.input_R2="No_File"
 params.expected_output = ""
+
 include { cutadapt } from '../main'
 
 process file_smart_diff {
@@ -56,7 +59,7 @@ process file_smart_diff {
     tar xvf !{output_tgz} -C actual
     tar xvf !{expected_tgz} -C expected
 
-    export NAME=`basename !{output_tgz} .cutadapt.log.qc.tgz`
+    export NAME=`basename !{output_tgz} .cutadapt.tgz`
 
     diff actual/tar_content.json expected/tar_content.json \
       && ( echo "TAR_CONTENT: Test PASSED" && exit 0 ) || ( echo "TAR_CONTENT: Test FAILED. tar_content.json files do not match" && exit 1 )
@@ -74,20 +77,22 @@ process file_smart_diff {
 }
 workflow checker {
   take:
+    read_group_id
     input_R1
     input_R2
     expected_tgz
   main:
     cutadapt(
-      file(params.input_R1), file(params.input_R2)
+      tuple(read_group_id, input_R1, input_R2)
     )
     file_smart_diff(
-      cutadapt.out.output_tgz,
+      cutadapt.out.cutadapt_tar,
       expected_tgz
     )
 }
 workflow {
   checker(
+    params.read_group_id,
     file(params.input_R1),
     file(params.input_R2),
     file(params.expected_tgz)
diff --git a/cutadapt/tests/expected/expected-TCRBOA7-T-RNA.cutadapt.log.qc.tgz b/cutadapt/tests/expected/expected-TCRBOA7-T-RNA.cutadapt.log.qc.tgz
deleted file mode 100644
index 2fb7735..0000000
Binary files a/cutadapt/tests/expected/expected-TCRBOA7-T-RNA.cutadapt.log.qc.tgz and /dev/null differ
diff --git a/cutadapt/tests/expected/expected.test-job-1.cutadapt.tgz b/cutadapt/tests/expected/expected.test-job-1.cutadapt.tgz
new file mode 100644
index 0000000..c0dcfe8
Binary files /dev/null and b/cutadapt/tests/expected/expected.test-job-1.cutadapt.tgz differ
diff --git a/cutadapt/tests/expected/expected.test-job-2.cutadapt.tgz b/cutadapt/tests/expected/expected.test-job-2.cutadapt.tgz
new file mode 100644
index 0000000..c1bc90c
Binary files /dev/null and b/cutadapt/tests/expected/expected.test-job-2.cutadapt.tgz differ
diff --git a/cutadapt/tests/test-job-1.json b/cutadapt/tests/test-job-1.json
index 76e96d0..21654a5 100644
--- a/cutadapt/tests/test-job-1.json
+++ b/cutadapt/tests/test-job-1.json
@@ -1,7 +1,8 @@
 {
+    "read_group_id": "TEST-RNA",
     "input_R1": "input/TCRBOA7-T-RNA.250reads.read1.fastq.gz",
     "input_R2": "input/TCRBOA7-T-RNA.250reads.read2.fastq.gz",
-    "expected_tgz": "expected/expected-TCRBOA7-T-RNA.cutadapt.log.qc.tgz",
+    "expected_tgz": "expected/expected.test-job-1.cutadapt.tgz",
     "publish_dir": "outdir",
     "cpus": 1,
     "mem": 0.5
diff --git a/cutadapt/tests/test-job-2.json b/cutadapt/tests/test-job-2.json
new file mode 100644
index 0000000..aad75e8
--- /dev/null
+++ b/cutadapt/tests/test-job-2.json
@@ -0,0 +1,8 @@
+{
+    "read_group_id": "TEST-RNA",
+    "input_R1": "input/TCRBOA7-T-RNA.250reads.read1.fastq.gz",
+    "expected_tgz": "expected/expected.test-job-2.cutadapt.tgz",
+    "publish_dir": "outdir",
+    "cpus": 1,
+    "mem": 0.5
+}