Add nucleotide-count (#149)

config.json

@@ -109,6 +109,14 @@
         ],
         "difficulty": 1
       },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "21826136-f2ec-4b5c-968b-e2ec2dfe9171",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
+      },
       {
         "slug": "protein-translation",
         "name": "Protein Translation",

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```

exercises/practice/nucleotide-count/.meta/config.json

@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "BNAndras"
+  ],
+  "files": {
+    "solution": [
+      "nucleotide-count.red"
+    ],
+    "test": [
+      "nucleotide-count-test.red"
+    ],
+    "example": [
+      ".meta/example.red"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}

exercises/practice/nucleotide-count/.meta/example.red

@@ -0,0 +1,24 @@
+Red [
+	description: {"Nucleotide Count" exercise solution for exercism platform}
+	author: "BNAndras"
+]
+
+nucleotide-counts: function [
+	strand
+] [
+	counts: make map! [A 0 C 0 G 0 T 0]
+
+	foreach char strand [
+		switch/default char [
+			#"A" [set 'counts/A 1 + get 'counts/A]
+			#"C" [set 'counts/C 1 + get 'counts/C]
+			#"G" [set 'counts/G 1 + get 'counts/G]
+			#"T" [set 'counts/T 1 + get 'counts/T]
+		] [
+			cause-error 'user 'message "Invalid nucleotide in strand"
+		]
+	]
+
+	counts
+]
+

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"

exercises/practice/nucleotide-count/nucleotide-count-test.red

@@ -0,0 +1,93 @@
+Red [
+	description: {Tests for "Nucleotide Count" Exercism exercise}
+	author: "loziniak"
+]
+
+#include %testlib.red
+
+test-init/limit %nucleotide-count.red 1
+; test-init/limit %.meta/example.red 1						; test example solution
+
+canonical-cases: [#(
+    description: "empty strand"
+    input: #(
+        strand: ""
+    )
+    expected: #(
+        A: 0
+        C: 0
+        G: 0
+        T: 0
+    )
+    function: "nucleotide-counts"
+    uuid: "3e5c30a8-87e2-4845-a815-a49671ade970"
+) #(
+    description: {can count one nucleotide in single-character input}
+    input: #(
+        strand: "G"
+    )
+    expected: #(
+        A: 0
+        C: 0
+        G: 1
+        T: 0
+    )
+    function: "nucleotide-counts"
+    uuid: "a0ea42a6-06d9-4ac6-828c-7ccaccf98fec"
+) #(
+    description: "strand with repeated nucleotide"
+    input: #(
+        strand: "GGGGGGG"
+    )
+    expected: #(
+        A: 0
+        C: 0
+        G: 7
+        T: 0
+    )
+    function: "nucleotide-counts"
+    uuid: "eca0d565-ed8c-43e7-9033-6cefbf5115b5"
+) #(
+    description: "strand with multiple nucleotides"
+    input: #(
+        strand: {AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC}
+    )
+    expected: #(
+        A: 20
+        C: 12
+        G: 17
+        T: 21
+    )
+    function: "nucleotide-counts"
+    uuid: "40a45eac-c83f-4740-901a-20b22d15a39f"
+) #(
+    description: "strand with invalid nucleotides"
+    input: #(
+        strand: "AGXXACT"
+    )
+    expected: #(
+        error: "Invalid nucleotide in strand"
+    )
+    function: "nucleotide-counts"
+    uuid: "b4c47851-ee9e-4b0a-be70-a86e343bd851"
+)]
+
+
+foreach c-case canonical-cases [
+	expect-code: compose [
+		(to word! c-case/function) (values-of c-case/input)
+	]
+	case-code: reduce
+		either all [
+			map? c-case/expected
+			string? c-case/expected/error
+		] [
+			['expect-error/message quote 'user expect-code c-case/expected/error]
+		] [
+			['expect c-case/expected expect-code]
+		]
+
+	test c-case/description case-code
+]
+
+test-results/print

exercises/practice/nucleotide-count/nucleotide-count.red

@@ -0,0 +1,11 @@
+Red [
+	description: {"Nucleotide Count" exercise solution for exercism platform}
+	author: "" ; you can write your name here, in quotes
+]
+
+nucleotide-counts: function [
+	strand
+] [
+	cause-error 'user 'message "You need to implement nucleotide-counts function."
+]
+