Skip to content

Commit

Permalink
added WCB as separate panel to reduce coverage threshold
Browse files Browse the repository at this point in the history
  • Loading branch information
mcgml committed May 4, 2017
1 parent f15e7f2 commit 939fc2b
Show file tree
Hide file tree
Showing 42 changed files with 2,457 additions and 43 deletions.
2 changes: 1 addition & 1 deletion 1_SomaticAmplicon.sh
View file
Original file line number Diff line number Diff line change
Expand Up @@ -8,7 +8,7 @@ cd $PBS_O_WORKDIR
#Description: Somatic Amplicon Pipeline (Illumina paired-end). Not for use with other library preps/ experimental conditions.
#Author: Matt Lyon, All Wales Medical Genetics Lab
#Mode: BY_SAMPLE
version="1.5.0"
version="1.6.0"

# Directory structure required for pipeline
#
Expand Down
5 changes: 5 additions & 0 deletions NGHS-101X-WCB/NGHS-101X.variables
View file
Original file line number Diff line number Diff line change
@@ -0,0 +1,5 @@
read1Adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC #read 1 adapter to trim
read2Adapter=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT #read 2 adapter to trim
padding=250 #Amount of padding for GATK preprocessing.
minimumCoverage=150 # for passing regions. Need to determine during clinical validation
expectedInsertSize=200 #insert size
38 changes: 38 additions & 0 deletions NGHS-101X-WCB/NGHS-101X_KnownVariants.vcf
View file
Original file line number Diff line number Diff line change
@@ -0,0 +1,38 @@
##fileformat=VCFv4.1
##INFO=<ID=Classification,Number=1,Type=Integer,Description="Variant pathogenicity classification, 0=Artefact, 1=Clearly not pathogenic, 2=Unlikely to be pathogenic, 3=Unknown significance, 4=Likely to be pathogenic, 5=Clearly pathogenic">
##INFO=<ID=Submitter,Number=1,Type=String,Description="Submitter name">
##INFO=<ID=Authoriser,Number=1,Type=String,Description="Authoriser name">
##INFO=<ID=Evidence,Number=1,Type=String,Description="Classification evidence">
##INFO=<ID=DateAdded,Number=1,Type=String,Description="Date added">
#CHROM POS ID REF ALT QUAL FILTER INFO
1 162737116 . C G . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
2 209113192 . G A . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
3 178937025 . T C . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
3 178943762 . A G . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
4 1803704 . T C . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
4 1807894 . G A . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
4 55141055 . A G . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
4 55141111 . G T . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
4 55141120 . C CT . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
4 55152040 . C T . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
4 55599306 . T C . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
7 55249063 . G A . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
7 55266417 . T C . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
7 55266525 . T C . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
7 55266531 . C T . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
7 116422040 . A C . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
7 116423400 . T A . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
10 43613843 . G T . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
10 89720633 . C CT . . Classification=0;Submitter=Rhi;Authoriser=Michelle;Evidence=None;DateAdded=24/04/2015
10 89720633 . C CTT . . Classification=0;Submitter=Rhi;Authoriser=Michelle;Evidence=None;DateAdded=24/04/2015
10 89720633 . CT C . . Classification=0;Submitter=Rhi;Authoriser=Michelle;Evidence=None;DateAdded=24/04/2015
10 89720633 . CTT C . . Classification=0;Submitter=Rhi;Authoriser=Michelle;Evidence=None;DateAdded=24/04/2015
10 89720633 . C T . . Classification=0;Submitter=Rhi;Authoriser=Michelle;Evidence=None;DateAdded=24/04/2015
17 7576841 . A G . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=03/12/2015
17 7578210 . T C . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=03/12/2015
17 7579472 . G C . . Classification=1;Submitter=Rhi;Authoriser=Michelle;Evidence=None;DateAdded=24/04/2015
17 7579579 . C T . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=03/12/2015
17 37865659 . C T . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
17 37879588 . A G . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
17 37881082 . G A . . Classification=0;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2016
17 37884037 . C G . . Classification=1;Submitter=Michelle;Authoriser=Michelle;Evidence=None;DateAdded=15/06/2015
Binary file added NGHS-101X-WCB/NGHS-101X_KnownVariants.vcf.idx
View file
Binary file not shown.
24 changes: 24 additions & 0 deletions NGHS-101X-WCB/NGHS-101X_PreferredTranscripts.txt
View file
Original file line number Diff line number Diff line change
@@ -0,0 +1,24 @@
AKT1 NM_005163.2
ALK NM_004304.4
AR NM_000044.3
BRAF NM_004333.4
CTNNB1 NM_001904.3
DDR2 NM_006182.2
EGFR NM_005228.3
ERBB2 NM_004448.2
FGFR3 NM_000142.4
GNA11 NM_002067.2
GNAQ NM_002072.4
IDH1 NM_005896.2
IDH2 NM_002168.2
KIT NM_000222.2
KRAS NM_004985.3
MAP2K1 NM_002755.3
MET NM_001127500.1
NRAS NM_002524.4
PDGFRA NM_006206.4
PIK3CA NM_006218.2
PTEN NM_000314.4
RET NM_020975.4
STK11 NM_000455.4
TP53 NM_000546.5
Loading

0 comments on commit 939fc2b

Please sign in to comment.