rust-de Bruijn graphs

• construction of de Bruijn graphs using BTreeMaps.
• gives you a binary search implementation by in the end encoding the MapStore and the string as a BtreeMap, which can be easily used into the Binary Heap as a priority queue.
• uses graphviz for writing the dot files:
• writes colour coded dot files for visualization with graphviz crate and graphviz_rust
• general note: Incase of Golang and RUST, please see the last commit message and if it says compiled binary then it is completed or else still in development version.

cargo build 

• to build he binary and build the hashes

 ➜ gauravsablok  rust-de-Bruijn-graphs git:(main) ✗ ./target/debug/rust-de-Bruijn-graphs -h
Usage: rust-de-Bruijn-graphs <DEBRUIJN_ARG> <KMER_ARG>

Arguments:
 <DEBRUIJN_ARG>  please provide the path to the fastq file
 <KMER_ARG>      please provide the kmer for the graph construction

Options:
 -h, --help     Print help
 -V, --version  Print version

./target/debug/rust-de-Bruijn-graphs ./sample-files/sample.fasta 3

"ATATATGATAGATAGATGATGATGATAGATGATAGATGATGATGATAGTAGATGAT"      
MapStore { node_edge_relation: [NodeEdgeHold { node: "AT", edge: "TA" }, 
NodeEdgeHold { node: "TA", edge: "AT" }, NodeEdgeHold { node: "AT", edge: "TA" }, NodeEdgeHold { node: "TA", edge: "AT" }, NodeEdgeHold { node: "AT", edge: "TG" }, NodeEdgeHold { node: "TG", edge: "GA" }, NodeEdgeHold { node: "GA", edge: "AT" }, NodeEdgeHold { node: "AT", edge: "TA" }, NodeEdgeHold { node: "TA", edge: "AG" }, NodeEdgeHold { node: "AG", edge: "GA" }, 
NodeEdgeHold { node: "GA", edge: "AT" },

Gaurav Sablok